Anti-aging Treatments Slow Propagation Of Synucleinopathy By Restoring Lysosomal Function Ⅱ

Mar 30, 2023

Discussion

We have developed a quantitative, real-time technique for the study of cell-to-cell transmission of SNCA in C. elegans. The model exhibits many key features of synucleinopathy, including the progressive accumulation of SNCA aggregates, nerve degeneration, behavioral deficits, and reduced life span. Both the genetic and pharmacological manipulations of animals have shown strong correlations among aging rates, transcellular SNCA transmission, and neurodegenerative phenotypes, and likewise, various manipulations associated with anti-aging effects can slow the progression of these events. Aging-dependent progression of synucleinopathy is accompanied by a decline in protein degradation. Anti-aging treatments can restore the systems mediating protein degradation. Furthermore, restoration of lysosomal function alleviated the propagation of aggregates and the accompanying neurodegeneration in these aging models. BiFC is a widely used fluorescence technique that has been successfully applied to assess protein-protein interactions and protein dimerization and/or oligomerization in living cells.7 The V1S-SV2 BiFC pair has been shown to fluoresce upon dimerization/oligomerization of SNCA when these proteins are co-expressed in mammalian cells.7 In a previous study,17 by generating neuroblastoma cell lines expressing either one of V1S and SV2, we have shown that cell-to-cell transfer of SNCA proteins and coaggregation of the transferred proteins with the endogenous SNCA can be visualized with BiFC fluorescence during coculture of these cells.

anti-aging cistanche

Welcome to My Shop For Getting Herbs Cistanche For Anti-Aging Treatment

Buy Cistanche

Free shipping, and global delivery.

One of the important technical issues of the BiFC system is to verify the cell type-specific expression of each protein. Although quantitative analysis of SNCA transgenic expression in each cell type is not technically feasible, we have a series of data supporting the argument that SNCA is exclusively expressed only in the intended cell types. First, DsRed failures cancer is detected only in flip-21 neurons, not in the pharyngeal muscle cells at all. Second, immunofluorescence staining of SNCA with a highly specific and sensitive antibody exhibited the expression of this protein specifically in the intended cell types. Third, the expression of the same BiFC pair in the worms with the dyn-1 mutation signifificantly reduced the BiFC fluorescence signal, indicating that the generation of the BiFC fluorescence requires endocytosis. This suggests that the BiFC signal did not come from the coexpression of the BiFC pair in the same cell types but derived from the intercellular transmission of the proteins.


ion and the degenerative phenotypes presented in this study are robust and consistent, we should stress that this study does not provide definitive evidence for the cause-consequence relationship between aggregate transmission and neurodegeneration. Thus far, no animal model studies have clearly addressed the cause-consequence issue. The C. elegans model we generated in this study will be a valuable tool in addressing this issue. One of the important purposes of developing the BiFC system is to identify genetic and small molecule modifiers that regulate the transmission. By identifying flying modifiers, one should be able to regulate the rate and extent of intercellular transmission, thereby solving the cause-consequence problem. The fact that the transcellular congregation of SNCA was greatly modulated by mutations in such genes as dyn-1, asp-4, asp-1, daf-2, and daf-16, indicates that this system is amenable to modulation by genetic factors and this validates the

system for the identification of novel genetic modulators. In addition, the distinctive structure of the pharynx in C. elegans would allow for the convenient identification of changes in the transmission of syn synucleinopathy in large-scale screening for genetic and small-molecule modifiers.


Effects of aging processes on “transmission,” rather than the aggregation itself, is the key subject of the paper. Now, we would like to make it clear that we are not trying to argue that aging and lysosomal dysfunction only affect the transmission of aggregates without affecting cell-autonomous aggregation itself. Our BiFC system is an excellent system to quantify the transmission event, but not designed to monitor the call-autonomous aggregation. Previous studies,25-27 including our own,28 address the effects of lysosomal dysfunction in the clearance of cell-autonomous SNCA aggregation. However, we would also like to point out that there is no definitive proof that these studies have observed only the cell-autonomous aggregation excluding the effects of transcellular aggregate transmission and amplification. We would also like to emphasize that aggregation initiation is an absolute requirement for aggregate transmission. In fact, we show that the basal level cell-autonomous aggregation occurs spontaneously even in single transgenic animals (Fig. 8F). 

The anti-aging effects of GlcNAc had been described to be DAF-16-independent.12 This indicates that GlcNAc rescues the daf-16 phenotype not by directly affecting the DAF-16 pathway, but by acting through independent aging pathways. The data we present suggest that SNCA transmission is not under the control of a specific aging pathway, but is rather regulated by general aging.


anti-aging cistanche

Our current study provides a basis for considering the use of general anti-aging approaches as therapeutic strategies for stopping or slowing the progression of PD and related synucleinopathies. In addition, enhancers of lysosomal function can be considered as candidates for therapies aiming to stop or delay the progression of these diseases. The same approach could in theory be applied to other age-related neurodegenerative diseases, many of which are thought to progress through the propagation of specific protein aggregates. Assuming that the propagation of different protein aggregates shares the same basic principle, we cautiously speculate that anti-aging and pro-lysosome strategies could be developed into a general therapy for stopping the progression of much neurodegenerative diseases. This hypothesis can be addressed by applying the BiFC-based animal model to other transmission models involving MAPT, polyglutamine proteins, and TARDBP.1


Materials and methods

Strains and culturing of nematodes All strains were handled using standard procedures and grown, on nematode growth medium (NGM) plates containing a lawn of Escherichia coli (E. coli) strain OP50 at 20 C.29 Wild-type Bristol N2 and the mutant strains unc-119(ed3), dyn-1(ky51), and asp-4(ok2693) were obtained from the Caenorhabditis Genetics Center (CGC; the University of Minnesota, St. Paul, MN, USA). The mutant strain asp-1(tm666) was provided by C. elegans National BioResource Project (NBRP; Tokyo Women’s Medical University School of Medicine, Tokyo, Japan). The mutant strains daf-2(e1370) and daf-16(mu86) were generous gifts from Professor Kyuhyung Kim (DGIST, Daegu, Korea).


Plasmids construction for C. elegans

V1S and SV2 template plasmids were generous gifts from Dr. Pamela McLean (Massachusetts General Hospital, Boston, MA, USA). One) Pmyo-2::EGFP The myo-2 promoter (Pmyo-2) was PCR-amplified from genomic DNA obtained from wild-type N2 worms. 

A sense primer containing a HindIII site, 50 -GACAAGCTTGGGGTTTTGTGCTGTGGACGTT-30, and an antisense primer containing a BamHI site, 50 - GACGGATCCTTCTGTGTCTGACGATCGAGG-30 were used. Pmyo-2::EGFP was generated by inserting the PCR product into the HindIII and BamHI sites of the pFX_EGFPT vector.30 Two) Pmyo-2::SNCA(Myc) A sense primer containing a SalI site, 50 - AGCGTCGACGCCACCATGGATGTATTCATGAAAGGAC-30 and an antisense primer containing myc tag sequence and BglII site, 50 - AGCAGATCTCTACAGATCCTCTTCAGAGATGAGTTTCTGCTCG GCTTCAGGTTCGTAGTCTTG-30 were used to amplify the MYC-tagged human SNCA obtained from pcDNA3.1 MycHisSNCA vector.28 The EGFP fragment of Pmyo-2::EGFP was replaced by the PCR-amplified Myc-tagged human SNCA fragment to construct Pmyo-2::SNCA(Myc). Three) Pmyo-2::V1S A sense primer containing a SalI site, 50 - AGCGTCGACGCCACCATGGTGAGCAAGGCCGAGG-30, and an antisense primer containing a BglII site, 50 -AGCAGATCTTTAGGCTTCAGGTTCGTAGTC-30 were used to amplify V1S. In addition, the EGFP fragment of Pmyo-2::EGFP was replaced by the PCR-amplified V1S fragment to construct Pmyo-2::V1S. Four) Pmyo-2::V1Q25 A sense primer containing a claI site, 50 - TAAGCAATCGATATGGCGACCCTGGAAAAGCTG-30, and an antisense primer containing a claI site, 50 -TGCTTAATCGATAGGTCGGTGCAGAGGCTCCTC-30 were used to amplify Q25. Then, the human SNCA fragment of Pmyo-2::V1S was replaced by the PCR-amplified Q25 fragment to construct Pmyo-2::V1Q25. Four) Pflflp-21::SV2 The EGFP fragment of pFX_EGFPT was replaced by the PCR-amplified SV2 fragment to make an SV2 vector. 

anti-aging cistanche

The sense primer containing a SpeI site, 50 -AGCACTAGTGCCACCATGGATGTATTCATGAAAGG-30, and an antisense primer containing a BglII site, 50 -AGCAGATCTTACTTGTACAGCTCGTCCATGC CG-30 were used. The flip-21 promoter (Pflflp-21) was PCR-amplified from N2 genomic DNA and subcloned into KpnI and SalI sites of the SV2 vector to generate Pflflp-21::SV2. A sense primer containing a KpnI site, 50 - AGCGGTACCAACTAGGTCCAGTGACCGAAAG-30 and an antisense primer containing a SalI site, 50 -AGCGTCGACGCCACCATGGATGTATTCATGAAAGGAC-30 were used to amplify the flflp-21 promoter. Five) Pflflp-21::SV2-ICR-DsRed To make an SV2 vector coexpressing DsRed as a pharyngeal neuronal marker, Pflflp-21 was subcloned into the KpnI and SalI sites of the pFX_DsRedxT vector30 and named Pflflp-21::DsRed. Coexpression of SV2 and DsRed under the flflp-21 promoter was achieved by placing an inter cistronic region (ICR) between SV2 and DsRed, which was PCR-amplified from N2.31 The SV2 fragment was fused with the ICR region by fusion PCR32 and subcloned into the Pflflp-21::DsRed to construct Pflflp-21::SV2-ICRDsRed. A sense primer containing a SalI site, 50 -AGCGTCGACGCCACCATGGATGTATTCATGAAAGGAC-30, and an antisense primer containing an overlapping region with an ICR, 50 -CGATCATTTTGGAGATTACTTGTACAGCTTGTCC-30 was used in the PCR reaction for SV2. The ICR region was amplified with a sense primer containing an overlapping region with SV2, 50 -GGACGAGCTGTACAAGTAATCTCCAAAATCATCG-30, and an antisense primer containing a SpeI site 50 - AGCACTAGTTACCCTGTAATAATATATTAAAC-3


Establishment of BiFC transgenic worms 

Pmyo-2::V1S and Pflflp-21::SV2-ICR-DsRed plasmids were coinjected into the gonads of late L4-stage N2 worms with a selection marker, pRF4 which expresses a mutant collagen gene, rol- 6(su1006), 33 to make a double-transgenic line expressing the BiFC pair. As a negative control for BiFC, Pmyo-2::V1S alone was injected into N2 worms with pRF4, and Pflflp-21::SV2-ICRDsRed alone was injected into unc-119(ed3) mutant worms with a selection marker, pCFJ151, which expresses unc-119(C) gene.34 The plasmid Pmyo-2::V1 was generated to express the BiFC partial sequence only by introducing the stop codon right before the SNCA coding sequence in Pmyo-2::V1S using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, 200521). Pmyo-2::V1 and Pflflp-21::SV2-ICR-DsRed plasmids were then coinjected into N2 with pRF4. The plasmid Pmyo-2::V1Q25 was generated to express the huntingtin exon 1 with a 25 glutamine stretch by replacing SNCA with the Q25 fragment in Pmyo-2:: V1S. Pmyo-2::V1Q25 and Pflflp-21::SV2-ICR-DsRed plasmids were then coinjected into N2 with pRF4. In addition, Pflflp-21::DsRed was injected into N2 with pRF4 as a control for the effects of general protein overexpression in neurons. For chromosomal integration of the introduced plasmids, injected lines were exposed to UV irradiation. After UV irradiation, each integrated line was out-crossed 4 times with N2. Double transgenic lines carrying Pmyo-2::V1S and Pflflp-21::SV2-ICR-DsRed were generated by mating an integrated Pmyo-2::V1S line with an integrated Pflflp-21::SV2-ICR-DsRed line. All of these transgenic worms showed a roller phenotype and expression of DsRed

fluorescence in the pharyngeal neurons.

Generation of untagged SNCA models Pmyo-2::SNCA and Pflflp-21::SNCA plasmids were designed to express SNCA only by introducing a stop codon right after the SNCA coding sequence by using a QuikChange Site-Directed Mutagenesis Kit. As a negative control, Pmyo-2::SNCA alone was injected into N2 worms with pRF4. Pmyo-2::SNCA and Pflflp-21:: SNCA plasmids were coinjected into the gonads of late L4-stage N2 worms with pRF4. All of these worms showed a roller phenotype and 3 representative lines of each genotype were used for experiments. Generation of aging-related BiFC models Pmyo-2::V1S and Pflflp-21::SV2-ICR-DsRed plasmids were coinjected into the gonads of late L4-stage daf-2(e1370) and daf-16 (mu86) mutant worms with the pRF4. As a control for aging-related BiFC models, Pmyo-2::V1S or Pflflp-21::SV2-ICR-DsRed alone was injected into the gonads of late L4-stage of N2 and daf-16(mu86) mutant worms with pRF4. After several transgenic lines containing the introduced plasmids were obtained, 3 representative lines in each mutant background were used for experiments.



Generation of hlh-30p::hlh-30 transgenic lines

A plasmid expressing hlh-30p::hlh-30::gfp was a generous gift from Dr. Malene Hansen (Sanford-Burnham Medical Research Institute, CA, USA). The plasmid hlh-30p::hlh-30 was designed to introduce stop codon before the GFP coding sequence using a QuikChange Site-Directed Mutagenesis Kit to inhibit GFP expression. As a control, each Pmyo-2::V1S or Pflflp-21::SV2-ICRDsRed and hlh-30p::hlh-30 were coinjected into the gonads of late L4-stage N2 worms with pRF4. The plasmids expressing Pmyo-2::V1S, Pflflp-21::SV2-ICR-DsRed and hlh-30p::hlh-30 were coinjected into the gonads of late L4-stage daf-16(mu86) mutant worms with pRF4. To analyze lysosomal dysfunction, asp-4(ok2693) and asp-1(tm666) mutant worms, in which the lysosomal enzyme cathepsin gene is inactivated, were used. Pmyo-2::V1S and Pflflp-21::SV2-ICR-DsRed plasmids were coinjected into the gonads of late L4-stage mutant worms with pRF4. After transgenic lines containing the introduced plasmids were obtained, 3 representative lines of each genotype were used for experiments.


Immunofluorescence microscopy

For immunofluorescence staining of worms, wild-type N2 and transgenic worms were collected, washed with M9 buffer (22 mM KH2PO4, 22 mM Na2HPO4, 85 mM NaCl, 1 mM MgSO4), and then pre-fixed with 4% paraformaldehyde in MRWB (80 mM KCl, 20 mM NaCl, 10 mM EGTA, 5 mM spermidine [Sigma-Aldrich, S0266], 50% methanol). To reduce cuticle layer rigidity for penetrance, the worms were subjected to several freeze/thaw cycles using liquid nitrogen, and incubated with agitation at 4 C for 2 h. Because reduction and oxidation steps increase the permeability of the worm, the worms were washed with Tris-Triton buffer (100 mM Tris-HCl, pH 7.4, 1% Triton X-100 [Bio-Rad laboratories Inc., 161–0407], 1 mM EDTA), and incubated with 1% b-mercaptoethanol (Sigma-Aldrich, M7522) in Tris-Triton buffer at room temperature (RT) for 2 h. Subsequently, the worms were incubated in collagenase solution (100 units of collagenase type IV [Worthington Biochemical Co., LS004188] in 100 mM Tris-HCl, pH 7.4, 1 mM CaCl2, 0.1% Triton X-100) with rotation for 4 h at RT. Then the worms were incubated in Tris-Triton buffer supplemented with 0.3% H2O2 (Sigma-Aldrich, H1009) for 15 min at RT. After incubation in blocking buffer (0.1% bovine serum albumin [BSA; Sigma-Aldrich, A7906], 0.5% Triton X-100, 1 mM EDTA in phosphate-buffered saline [PBS; GenDEPOT, CAP08-050]), the worms were incubated with monoclonal antibody 274 mAb10 overnight at 4 C in primary antibody solution (1% BSA, 0.5% Triton X-100, 1 mM EDTA in PBS). The following day, the worms were washed with blocking buffer and incubated with rhodamine red X-conjugated goat anti-mouse IgG (1:100; Jackson Immunoresearch Laboratories, 115-295-166) for 2 h. The worms were then washed with a blocking buffer and mounted in an Antifade reagent (Invitrogen, P36930). Samples were analyzed using an Olympus FV1000 confocal laser-scanning microscope (Olympus, Tokyo, Japan).


Fluorescence microscopy of live worms

Worms were immobilized with 10 mM sodium azide in M9 buffer, and covered with a coverslip. Images of the worms were acquired using Olympus FV1000 confocal laser scanning microscopy. 

Western blotting

Adult worms were washed with M9 buffer and subsequently with PBS containing 1% Triton X-100. The worm pellet was sonicated in PBS containing 1% Triton X-100, 1% (vol/vol) protease inhibitor cocktail (Sigma-Aldrich, P8340) and centrifuged to obtain the Triton-soluble (supernatant) and -insoluble (pellet) fractions. Protein concentration was measured using the BCA protein assay (Pierce Biotechnology, 23223 and 23224). Protein samples (3 mg for SNCA expression test, 50 mg to detect polyubiquitin proteins, and 20 mg (V1S, V1SCSV2 lines) and 40 mg (SV2 lines) for differential solubility of SNCA) were loaded onto 12% SDS-PAGE gels. The primary antibodies used for western blotting were monoclonal anti-SNCA antibody, 274 mAb (1:1,500) and Syn-1 (1:1,500; BD BioScience, 610787), and anti-ubiquitin antibody (1:3,000; Abcam, ab7254). Chemiluminescence detection was performed using the LAS-3000 luminescence image analyzer (Fujifilm, Tokyo, Japan) and Amersham imager 600 (Ge Healthcare Life Sciences, Marlborough, MA, USA), and Multi Gauge (v3.0) software (Fujifilm, Tokyo, Japan).


Dot blotting

Adult worms of each strain were washed with M9 buffer and subsequently with PBS containing 1% Triton X-100. The worm pellet was sonicated in PBS containing 1% Triton X-100 and 1% (vol/vol) protease inhibitor cocktail. Protein samples (500 ng) were loaded onto nitrocellulose membranes, which were then dried and incubated in a blocking solution. The primary antibodies used for dot blotting were the monoclonal anti-SNCA antibodies 274 mAb and Syn-O2,13 the latter of which is specific for SNCA aggregates. Chemiluminescence detection was performed using the LAS-3000 luminescence image analyzer and Amersham imager 600, and Multi Gauge (v3.0) software.


Anti-aging agent treatment

N-acetylglucosamine (GlcNAc) (Sigma-Aldrich, A8625) was dissolved in distilled water to 1 M as stock solution. The stock solution was diluted with LB liquid medium (Sigma-Aldrich, L3022). The L4-stage worms of each transgenic line were transferred to NGM plates containing a final concentration of 10 mM GlcNAc. Single-worm PCR A gravid single worm from each line was lysed in lysis buffer (50 mM KCl, 10 mM Tris-HCl, pH 8.3, 2.5 mM MgCl2, 0.45% NP-40 [IGEPAL; Sigma-Aldrich, I3021], 0.45% Tween 20 [Sigma-Aldrich, P1379]) with 0.1 mg/ml proteinase K (SigmaAldrich, P4850). The single worm in the buffer was subjected to several freeze-thaw cycles using liquid nitrogen, incubated at 65 C for 1 h to release genomic DNA, and then heated at 95 C for 15 min to inactivate proteinase K. Single-worm PCR analysis was performed using Ex TaqTM polymerase (Takara Biotechnology, RR001A) in Bio-Rad MyCycler PCR Thermal Cycler system (Bio-Rad Laboratories Inc., Hercules, CA, USA).

anti-aging cistanche

PCR-restriction fragment length polymorphism genotyping 

Gravid 5 worms from each line were lysed in the lysis buffer with 0.1 mg/ml proteinase K. Worms in the buffer were subjected to several freeze-thaw cycles using liquid nitrogen, incubated at 65 C for 1 h to release genomic DNA, and then heated at 95 C for 15 min to inactivate proteinase K. After performing PCR, the PCR products were digested with the NcoI enzyme (New England Biolabs Inc., R3193S), at 37 C overnight and electrophoresed to detect restriction fragment length polymorphism.

 

Quantitative PCR (qPCR) 

Adult transgenic worms were collected and washed in M9 buffer. The worms in the buffer were sonicated and the samples were subjected to several freeze-thaw cycles using liquid nitrogen. RNA was extracted with Trizol Reagent (Invitrogen, 15596-026) and purified using the RNeasy mini kit (Qiagen, 74106). Each cDNA was synthesized from 500 ng of total RNA using the iScript cDNA synthesis kit (Bio-Rad Laboratories Inc., 170–8891). For real-time PCR, target genes and specifific primers were mixed with SYBR Premix Ex Taq II (Takara Biotechnology, RR081A) in 96-well plates. Specific primers previously designed by other groups were used.14 The DNA products were analyzed using the 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). Relative mRNA levels of target genes were normalized to act-1.


Heat-shock treatment of the dyn-1 mutant

The double-transgenic worms (Pmyo-2::V1S C Pflflp-21::SV2-ICRDsRed) were mated with dyn-1(ky51) mutant worms.20 Adult mother worms of the double-transgenic line, with or without the dyn-1(ky51) mutation, were cultured on NGM plates containing E. coli OP50 for 4 h at 20 C to lay eggs, and were then removed. Synchronized progeny worms of each strain at the L4-stage were cultured at 30 C for observation. 


Pharyngeal pumping analysis

Pharyngeal pumping was counted for 1 min at RT using a fluorescence microscope. Wild-type N2, mutants and transgenic worms were analyzed. The data were expressed as PPM (pumps per minute).


Life-span assay

Eggs laid by adult mother worms were synchronously grown up to the L4 larval stage on NGM plates seeded with E. coli OP50 at 20 C. The L4-stage worms were transferred to NGM plates containing 100 mM 5-flfluoro-20 -deoxyuridine (Sigma-Aldrich, F0503) to prevent them from producing progeny. The number of worms that were alive or dead was recorded every one or 2 d. Worms that ruptured, burrowed, or crawled off the plates were censored but included in the life-span analysis as censored animals. The survival data were analyzed by using OASIS (an online application for the survival analysis of life-span assays.


Statistical analysis

All experiments were performed blind-coded and repeated at least 3 times. The values in the figures are expressed as mean Differences were considered signifificant if P values were § < SEM. 0.05. The graphs were drawn using Prism 5 software (Graphpad Software Inc., San Diego, CA, USA). Values were compared by one-way ANOVA with the Tukey posthoc test using InStat (version 3.05) software (Graphpad Software Inc., San Diego, CA, USA). 

Abbreviations 

ACTB actin, b 

AD Alzheimer disease 

Ab amyloid b

ALS amyotrophic lateral sclerosis

BiFC bimolecular fluorescence complementation 

GlcNAc N-acetylglucosamine 

PD Parkinson disease

Pmyo-2
myo-2 promoter
Pflflp-21
flflp-21 promoter
PCR polymerase chain reaction
SNCA synuclein, a
TFEB transcription factor EB


Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.


Funding

This work was supported by the National Research Foundation (NRF) grant funded by the Korean Government (MEST) (NRF-2015R1A2A1A10052540, NRF-2015R1A2A1A15053661), and the Korea Health Technology R&D Project, Ministry of Health & Welfare, Republic of Korea (HI14C0093), as well as the 2014 KU Brain Pool Program of Konkuk University.


References

[1] Brundin P, Melki R, Kopito R. Prion-like transmission of protein aggregates in neurodegenerative diseases. Nat Rev Mol Cell Biol 2010; 11:301-7; PMID:20308987; http://dx.doi.org/10.1038/nrm2873

[2] Lee SJ, Desplats P, Sigurdson C, Tsigelny I, Masliah E. Cell-to-cell transmission of non-prion protein aggregates. Nat Rev Neurol 2010; 6:702-6; PMID:21045796; http://dx.doi.org/10.1038/nrneurol.2010.145 

[3] Jucker M, Walker LC. Self-propagation of pathogenic protein aggregates in neurodegenerative diseases. Nature 2013; 501:45-51; PMID:24005412; http://dx.doi.org/10.1038/nature12481

[4] Bae EJ, Lee HJ, Rockenstein E, Ho DH, Park EB, Yang NY, Desplats P, Masliah E, Lee SJ. Antibody-aided clearance of extracellular a-synuclein prevents cell-to-cell aggregate transmission. J Neurosci 2012; 32:13454-69; PMID:23015436; http://dx.doi.org/ 10.1523/JNEUROSCI.1292-12.2012

[5] Tran HT, Chung CH, Iba M, Zhang B, Trojanowski JQ, Luk KC, Lee VM. Alpha-synuclein immunotherapy blocks uptake and templated propagation of misfolded a-synuclein and neurodegeneration. Cell Rep 2014; 7:2054-65; PMID:24931606; http://dx.doi.org/10.1016/j. cell rep.2014.05.033

[6] Lee HJ, Bae EJ, Lee SJ. Extracellular a–synuclein-a novel and crucial factor in Lewy body diseases. Nat Rev Neurol 2014; 10:92-8; PMID:24468877; http://dx.doi.org/10.1038/nrneurol.2013.275

[7] Outeiro TF, Putcha P, Tetzlaff JE, Spoelgen R, Koker M, Carvalho F, Hyman BT, McLean PJ. Formation of toxic oligomeric a-synuclein species in living cells. PLoS One 2008; 3:e1867; PMID:18382657; http://dx.doi.org/10.1371/journal.pone.0001867 

[8] McKay JP, Raizen DM, Gottschalk A, Schafer WR, Avery L. eat-2 and eat-18 are required for nicotinic neurotransmission in the Caenorhabditis elegans pharynx. Genetics 2004; 166:161-9; PMID:15020415; http://dx.doi. org/10.1534/genetics.166.1.161 

[9] Rogers C, Reale V, Kim K, Chatwin H, Li C, Evans P, de Bono M. Inhibition of Caenorhabditis elegans social feeding by FMRFamiderelated peptide activation of NPR-1. Nat Neurosci 2003; 6:1178-85; PMID:14555955; http://dx.doi.org/10.1038/nn1140

[10] Lee HJ, Bae EJ, Jang A, Ho DH, Cho ED, Suk JE, Yun YM, Lee SJ. Enzyme-linked immunosorbent assays for a-synuclein with species and multimeric state specificities. J Neurosci Methods 2011; 199:249-57; PMID:21658411; http://dx.doi.org/10.1016/j. Nemeth.2011.05.020 

[11] Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R. A C. elegans mutant that lives twice as long as wild type. Nature 1993; 366:461-4; PMID:8247153; http://dx.doi.org/10.1038/366461a0

[12] Denzel MS, Storm NJ, Gutschmidt A, Baddi R, Hinze Y, Jarosch E, Sommer T, Hoppe T, Antebi A. Hexosamine pathway metabolites enhance protein quality control and prolong life. Cell 2014; 156:1167-78; PMID:24630720; http://dx.doi.org/10.1016/j.cell.2014.01.061 

[13] Vaikath NN, Majbour NK, Paleologou KE, Ardah MT, van Dam E, van de Berg WD, Forrest SL, Parkkinen L, Gai WP, Hattori N, et al. Generation and characterization of novel conformation-specific monoclonal antibodies for a-synuclein pathology. Neurobiol Dis 2015; 79:81-99; PMID:25937088; http://dx.doi.org/ 10.1016/j.nbd.2015.04.009 

[14] Lapierre LR, De Magalhaes Filho CD, McQuary PR, Chu CC, Visvikis O, Chang JT, Gelino S, Ong B, Davis AE, Irazoqui JE, et al. The TFEB orthologue HLH-30 regulates autophagy and modulates longevity in Caenorhabditis elegans. Nat Commun 2013; 4:2267; PMID:23925298

[15] Vilchez D, Morantte I, Liu Z, Douglas PM, Merkwirth C, Rodrigues AP, Manning G, Dillin A. RPN-6 determines C. elegans longevity under proteotoxic stress conditions. Nature 2012; 489:263-8; PMID:22922647; http://dx.doi.org/10.1038/nature11315

[16] Hansen C, Angot E, Bergstrom AL, Steiner JA, Pieri L, Paul G, Outeiro TF, Melki R, Kallunki P, Fog K, et al. a-Synuclein propagates from mouse brain to grafted dopaminergic neurons and seeds aggregation in cultured human cells. J Clin Invest 2011; 121:715-25; PMID:21245577; http://dx.doi.org/10.1172/JCI43366 

[17] Bae EJ, Yang NY, Song M, Lee CS, Lee JS, Jung BC, Lee HJ, Kim S, Masliah E, Sardi SP, et al. Glucocerebrosidase depletion enhances cell-to-cell transmission of a-synuclein. Nat Commun 2014; 5:4755; PMID:25156829; http://dx.doi.org/10.1038/ncomms5755 

[18] Lee HJ, Suk JE, Bae EJ, Lee JH, Paik SR, Lee SJ. Assembly-dependent endocytosis and clearance of extracellular a-synuclein. Int J Biochem Cell Biol 2008; 40:1835-49; PMID:18291704; http://dx.doi.org/ 10.1016/j.biocel.2008.01.017

[19] Desplats P, Lee HJ, Bae EJ, Patrick C, Rockenstein E, Crews L, Spencer B, Masliah E, Lee SJ. Inclusion formation and neuronal cell death through neuron-to-neuron transmission of a-synuclein. Proc Natl Acad Sci U S A 2009; 106:13010-5; PMID:19651612; http://dx.doi. org/10.1073/pnas.0903691106 

[20] Clark SG, Shurland DL, Meyerowitz EM, Bargmann CI, van der Bliek AM. A dynamin GTPase mutation causes a rapid and reversible temperature-inducible locomotion defect in C. elegans. Proc Natl Acad Sci U S A 1997; 94:10438-43; PMID:9294229; http://dx.doi.org/ 10.1073/pnas.94.19.10438 

[21] Lee HJ, Cho ED, Lee KW, Kim JH, Cho SG, Lee SJ. Autophagic failure promotes the exocytosis and intercellular transfer of a-synuclein. Exp Mol Med 2013; 45:e22; PMID:23661100; http://dx.doi.org/ 10.1038/emm.2013.45

[22] Syntichaki P, Xu K, Driscoll M, Tavernarakis N. Specifific aspartyl and calpain proteases are required for neurodegeneration in C. elegans. Nature 2002; 419:939-44; PMID:12410314; http://dx.doi.org/ 10.1038/nature01108

[23] Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza M, Gennarino VA, Di Malta C, Donaudy F, Embrione V, Polishchuk RS, et al. A gene network regulating lysosomal biogenesis and function. Science 2009; 325:473-7; PMID:19556463 

[24] Grove CA, De Masi F, Barrasa MI, Newburger DE, Alkema MJ, Bulyk ML, Walhout AJ. A multiparameter network reveals an extensive divergence between C. elegans bHLH transcription factors. Cell 2009; 138:314-27; PMID:19632181; http://dx.doi.org/10.1016/j.cell.2009.04.058 

[25] Klucken J, Poehler AM, Ebrahimi-Fakhari D, Schneider J, Nuber S, Rockenstein E, Schlotzer-Schrehardt U, Hyman BT, McLean PJ, Masliah E, et al. Alpha-synuclein aggregation involves a bafilomycin A 1-sensitive autophagy pathway. Autophagy 2012; 8:754-66; PMID:22647715; http://dx.doi.org/10.4161/auto.19371 

[26] Yu WH, Dorado B, Figueroa HY, Wang L, Planel E, Cookson MR, Clark LN, Duff KE. Metabolic activity determines the efficacy of macro-autophagic clearance of pathological oligomeric a-synuclein. Am J Pathol 2009; 175:736-47; PMID:19628769; http://dx.doi.org/10.2353/ ajpath.2009.080928 

[27] Kilpatrick K, Zeng Y, Hancock T, Segatori L. Genetic and chemical activation of TFEB mediates clearance of aggregated a-synuclein. PloS one 2015; 10:e0120819; PMID:25790376; http://dx.doi.org/ 10.1371/journal.pone.0120819 

[28] Lee HJ, Khoshaghideh F, Patel S, Lee SJ. Clearance of a-synuclein oligomeric intermediates via the lysosomal degradation pathway. J Neurosci 2004; 24:1888-96; PMID:14985429; http://dx.doi.org/ 10.1523/JNEUROSCI.3809-03.2004














Tista 'Tħobb ukoll